D
Reaction score
16

Profile posts Latest activity Postings About

  • I've never played Emerald. My first Pokemon game was Pearl. I'm a noob, the only games I've played are Pearl, Heart Gold, and White. White is the best, though, and not just because it's the newest.

    Partially because I love Tepig so much, though. I fell in love with it the moment it was revealed. There was never any question which starter I would choose. :)
    Not yet, no. It's only just started so I have no strong opinions one way or the other.
    TGCTTCGAACTTCGGACTAGTCGAAAAGGCT

    EDIT: Just so this isn't spam, I'll add:

    What is your favorite Pokemon game?
    Random post to support you.

    Random Fact:
    DNA is made of cytosine, guanine, adenine, and thymine.
    That's why DNA strands are like CAGGTACGT and stuff.
    Hehe. Sorry. I'm on my DSi. So even if you hit 'Post Reply' once, it'll post it 3 times. So thats why I sometimes hate my DSi.
    Not yet. I wish I knew where it was. -_- I'll continue to look. Sorry.
    Not yet. I wish I knew where it was. -_- I'll continue to look. Sorry.
    Not yet. I wish I knew where it was. -_- I'll continue to look. Sorry.
    Hmm, latest profile views:

    BrOkenICE (Today - 08:01 PM)
    AnimeUSA (Today - 08:01 PM)
    Xdogking (Today - 07:23 PM)
    slickmario (Today - 07:17 PM)
    Water Pokémon Master (Today - 07:14 PM)
    Bippa201 (Today - 07:11 PM)
    Yoshidude10 (Today - 06:47 PM)
    Guy89 (Today - 06:32 PM)
    ShadowLugia (Today - 06:11 PM)
    safariblade (Today - 04:56 PM)

    Did someone besides me find this slightly amusing?
    We answer rulings questions on cards in the Pokemon TCG. See the Card Questions and Game Rulings forum? that's the forum we preside over.
  • Loading…
  • Loading…
  • Loading…
Back
Top